Chemical tracer diffusion of Sr and Co in polycrystalline Ca-deficient CaMnO3-δ with CaMn2O4 precipitates.

Diffusivity in the A- and B-sites CaMnO3 polycrystalline perovskite-δ-deficient Ca and spinel CaMn2O4 (marokite) as a secondary phase was studied using chemical tracers and secondary ion mass spectrometry (SIMS) equipped with electron probe microanalysis (EPMA). a thin film containing a chemical tracer Sr and Co is deposited on the polished surface of the polycrystalline composite samples followed by annealing at 800-1200 ° C for 96 hours. diffusion profile for each tracker is determined by SIMS, followed by calculation of the diffusion coefficient by fitting to the appropriate model.

Trackers Sr showed diffusion especially grating, with the activation energy of 210 ± 30 kJ mol-1, while the Co tracker shows the combination of lattice and enhanced grain boundary diffusion, with an activation energy of 270 ± 30 kJ mol-1 and 380 ± 40 kJ mol-1, each

The diffusivity can be used to predict the lifetime of the interdiffusion and the junctions between the n-type or CaMnO3 CaMnO3-δ-δ / CaMn2O4 composite and interlayers metallization or p-type material in the leg oxide thermoelectrics. In particular, relatively high diffusivity in polycrystalline CaMnO3 effective co-δ may play a role in reporting the rapid formation of a secondary phase (Ca3Co2-yMnyO6) between Ca3Co3.92O9 + p-type and n-type δ-δ CaMnO3 in a direct pn junction thermoelectric ,
A quick search in the database of scientific publications have demonstrated how the use of CRISPR-Cas genome engineering has considerably expanded edition, and growing importance, in modern molecular biology. Only in pub-med Platform, the search term gives more than 3000 results.

In particular, in Drug Discovery, Medicinal Chemistry and Chemical Biology in general CRISPR method may have multiple applications. Some of these applications are: resistance-election study of organic compounds lead antimalarial; druggability investigation; the development of animal models to test chemical compounds, etc. In this paper, we offer a review of the relevant scientific literature illustrated with specific examples of the application of CRISPR techniques for medicinal chemistry and chemical biology. We also present a general overview of the main trends regarding legal and ethical methods of genome editing.

 Chemical tracer diffusion of Sr and Co in polycrystalline Ca-deficient CaMnO3-δ with CaMn2O4 precipitates.
Chemical tracer diffusion of Sr and Co in polycrystalline Ca-deficient CaMnO3-δ with CaMn2O4 precipitates.

active modulation of carbonate chemistry calcifying fluid (δ11B, B / Ca) and seasonal invariant coral calcification in the sub-tropical boundary.

Coral calcification depends on both the supply of dissolved inorganic carbon (DIC) and the up-regulation of pH on calcifying fluid (cf). Using geochemical proxies (δ11B, B / Ca, Sr / Ca, Li / Mg), we show seasonal changes in pHcf and DICcf ​​to Acropora yongei and Pocillopora damicornis grown in-situ on Rottnest Island (32 ° S) in Western Australia , Changes in pHcf span of 8:38 in the summer to 8.60 in the winter, while DICcf ​​is 25 to 30% higher during the summer than the winter (× 1.5 × 2 to the sea). Thus, the two variables is up-regulated far above the values ​​of seawater and seasonal out of phase with each other.

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

DLR-bACE1-Mu-96T 96T
EUR 635
  • Should the Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, tissue homogenates, cerebrospinal fluid or other biological fluids.

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

DLR-bACE1-Ra-48T 48T
EUR 508
  • Should the Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

DLR-bACE1-Ra-96T 96T
EUR 661
  • Should the Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Hu-48Tests 48 Tests
EUR 500

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Hu-96Tests 96 Tests
EUR 692

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Mu-48Tests 48 Tests
EUR 511

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Mu-96Tests 96 Tests
EUR 709

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Ra-48Tests 48 Tests
EUR 534

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Ra-96Tests 96 Tests
EUR 742

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Hu-48Tests 48 Tests
EUR 478

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Hu-96Tests 96 Tests
EUR 662

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Mu-48Tests 48 Tests
EUR 489

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Mu-96Tests 96 Tests
EUR 677

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Ra-48Tests 48 Tests
EUR 511

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Ra-96Tests 96 Tests
EUR 709


RA21010 50 ug
EUR 435

Bace1/ Rat Bace1 ELISA Kit

ELI-02505r 96 Tests
EUR 886

BACE1 antibody

20R-BR014 50 ug
EUR 656
Description: Rabbit polyclonal BACE1 antibody

BACE1 antibody

20R-BR015 50 ug
EUR 656
Description: Rabbit polyclonal BACE1 antibody

BACE1 Antibody

EUR 349

BACE1 Antibody

EUR 146

BACE1 antibody

70R-15953 50 ul
EUR 435
Description: Rabbit polyclonal BACE1 antibody

BACE1 Antibody

35650-100ul 100ul
EUR 252

BACE1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BACE1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

BACE1 Antibody

DF7939 200ul
EUR 304
Description: BACE1 Antibody detects endogenous levels of total BACE1.

BACE1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

BACE1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

BACE1 antibody

70R-7276 50 ug
EUR 467
Description: Rabbit polyclonal BACE1 antibody raised against the N terminal of BACE1

Bace1 antibody

70R-8662 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Bace1 antibody

BACE1 protein

E62B011 20ug
EUR 343

BACE1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BACE1 Antibody

ABD7939 100 ug
EUR 438

BACE1 Antibody

ABD7999 100 ug
EUR 438


YF-PA17994 100 ug
EUR 403
Description: Rabbit polyclonal to BACE1

BACE1 Blocking Peptide

33R-3496 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BACE1 antibody, catalog no. 70R-7276

Polyclonal BACE1 Antibody

APG03188G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 . This antibody is tested and proven to work in the following applications:

BACE1 Blocking Peptide

DF7939-BP 1mg
EUR 195

bACE1 (pS498) Antibody

abx148520-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

BACE1 Conjugated Antibody

C35650 100ul
EUR 397

BACE1 cloning plasmid

CSB-CL002524HU-10ug 10ug
EUR 531
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggcccaagccctgccctggctcctgctgtggatgggcgcgggagtgctgcctgcccacggcacccagcacggcatccggctgcccctgcgcagcggcctggggggcgcccccctggggctgcggctgccccgggagaccgacgaagagcccgaggagcccggccggaggggca
  • Show more
Description: A cloning plasmid for the BACE1 gene.

BACE1 Polyclonal Antibody

ABP-PAB-31005 50 ug Ask for price
    • Product line: Proteases
    • Brand:

BACE1 Polyclonal Antibody

ABP-PAB-31006 50 ug Ask for price
    • Product line: Proteases
    • Brand:

BACE1 Rabbit pAb

A5266-100ul 100 ul
EUR 308

BACE1 Rabbit pAb

A5266-200ul 200 ul
EUR 459

BACE1 Rabbit pAb

A5266-20ul 20 ul
EUR 183

BACE1 Rabbit pAb

A5266-50ul 50 ul
EUR 223


HY-100182 5mg
EUR 2465

anti- BACE1 antibody

FNab00781 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC: 1:100-1:400
  • Immunogen: beta-site APP-cleaving enzyme 1
  • Uniprot ID: P56817
  • Gene ID: 23621
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against BACE1

Anti-BACE1 antibody

PAab00781 100 ug
EUR 386

Recombinant Human BACE1

P0562 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P56817
Description: Recombinant Human protein for BACE1

Anti-BACE1 antibody

STJ29911 100 µl
EUR 277
Description: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients.

Anti-BACE1 Antibody

STJ193186 200 µl
EUR 197

BACE1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BACE1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BACE1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EHB0322 96Tests
EUR 521


ELA-E0718h 96 Tests
EUR 824


EGTB0322 96Tests
EUR 521

Bovine BACE1 ELISA Kit

EBB0322 96Tests
EUR 521

Canine BACE1 ELISA Kit

ECB0322 96Tests
EUR 521

Chicken BACE1 ELISA Kit

ECKB0322 96Tests
EUR 521

Anserini bACE1 ELISA Kit

EAB0322 96Tests
EUR 521


EF006629 96 Tests
EUR 689

Mouse BACE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat BACE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BACE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BACE1 recombinant monoclonal antibody

A5095 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human BACE1 for WB,ELISA

Mouse bACE1 ELISA Kit

EMB0322 96Tests
EUR 521


ERB0322 96Tests
EUR 521


ESB0322 96Tests
EUR 521

Rabbit BACE1 ELISA Kit

ERTB0322 96Tests
EUR 521

Monkey BACE1 ELISA Kit

EMKB0322 96Tests
EUR 521

Porcine BACE1 ELISA Kit

EPB0322 96Tests
EUR 521

BACE1 Recombinant Protein (Human)

RP002572 100 ug Ask for price

BACE1 Recombinant Protein (Mouse)

RP118622 100 ug Ask for price

BACE1 Recombinant Protein (Mouse)

RP118625 100 ug Ask for price

BACE1 Recombinant Protein (Rat)

RP191804 100 ug Ask for price

Polyclonal BACE1 Antibody (N-term)

APG03026G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Bace1 antibody - middle region

APG03189G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Bace1 - middle region. This antibody is tested and proven to work in the following applications:

Guinea Pig BACE1 ELISA Kit

EGB0322 96Tests
EUR 521

Monoclonal BACE1 Antibody, Clone: 3C1C3

APR15123G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human BACE1. The antibodies are raised in Mouse and are from clone 3C1C3. This antibody is applicable in WB, FC, ICC, E

Polyclonal BACE1 / BACE Antibody (Internal)

APR11484G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 / BACE (Internal). This antibody is tested and proven to work in the following applications:

Bace1 ORF Vector (Rat) (pORF)

ORF063936 1.0 ug DNA
EUR 506

BACE1 ORF Vector (Human) (pORF)

ORF000858 1.0 ug DNA
EUR 95

Bace1 ORF Vector (Mouse) (pORF)

ORF039542 1.0 ug DNA
EUR 506

Bace1 ORF Vector (Mouse) (pORF)

ORF039543 1.0 ug DNA
EUR 506

Recombinant Human BACE1/ASP2 Protein

RP00165 20 μg
EUR 183

BACE1 ELISA Kit (Human) (OKAN05558)

OKAN05558 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

BACE1 ELISA Kit (Mouse) (OKAN05559)

OKAN05559 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. Homozygous knockout mice for this gene exhibit a wide range of nervous system defects, growth retardation, metabolic abnormalities, and increased neonatal lethality.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 14.1 pg/mL

BACE1 ELISA Kit (Rat) (OKCD02313)

OKCD02313 96 Wells
EUR 818
Description: Description of target: Responsible for the proteolytic processing of the amyloid precursor protein (APP). Cleaves at the N-terminus of the A-beta peptide sequence, between residues 671 and 672 of APP, leads to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

BACE1 ELISA Kit (Human) (OKCD06723)

OKCD06723 96 Wells
EUR 753
Description: Description of target: Cerebral deposition of amyloid beta peptide is an early and critical feature of Alzheimer's disease. Amyloid beta peptide is generated by proteolytic cleavage of amyloid precursor protein (APP) by two proteases, one of which is the protein. BACE1, a member of the peptidase A1 protein family, is a type I integral membrane glycoprotein and aspartic protease that is found mainly in the Golgi.Cerebral deposition of amyloid beta peptide is an early and critical feature of Alzheimer's disease. Amyloid beta peptide is generated by proteolytic cleavage of amyloid precursor protein (APP) by two proteases, one of which is the protein encoded by this gene. The encoded protein, a member of the peptidase A1 protein family, is a type I integral membrane glycoprotein and aspartic protease that is found mainly in the Golgi. Four transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.11ng/mL

BACE1 ELISA Kit (Mouse) (OKCD06724)

OKCD06724 96 Wells
EUR 779
Description: Description of target: Bace1 is responsible for the proteolytic processing of the amyloid precursor protein (APP). Bace1 cleaves at the N-terminus of the A-beta peptide sequence, between residues 671 and 672 of APP, leads to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 12.1pg/mL

BACE1 ELISA Kit (Mouse) (OKEH03206)

OKEH03206 96 Wells
EUR 662
Description: Description of target: Responsible for the proteolytic processing of the amyloid precursor protein (APP). Cleaves at the N-terminus of the A-beta peptide sequence, between residues 671 and 672 of APP, leads to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39 ng/mL

The net effect of these counter-cyclical behavior between DICcf ​​and pHcf is that the aragonite saturation state of liquid whitewash (Ωcf) rose ~ 4 times over the values ​​of seawater and ~ 25 to 40% higher during the winter than the summer , Thus, this coral control the chemical composition of the liquid whitewash to help maintain the level of calcification throughout the year in near-constant, despite the seasonal sea water temperature of only ~ 19 ° to 24 ° C. The ability of coral to up-regulate Ωcf is a key mechanism to optimize biomineralization, and thus it is important for the future of coral calcification under high CO2 conditions.