Coordination chemistry of Ca sites at the surface of nanosized hydroxyapatite: interaction with H₂O and CO.

Affinity to water well-defined selection, nanostructured hydroxyapatite (HA) samples were investigated by H (2) O vapor adsorption microcalorimetry and infrared (IR) spectroscopy. A great all the materials investigated hydrophilicity confirmed. Surface features of the hydrated HA investigated in the as-synthesized samples pre-treated under mild conditions at T = 303 K, while the HA features dehydration marked on the sample activated at T = 573 K.

The relative hydrophilicity of the surface hydrated (-Δ (ad) H ~ 100-50 kJ mol (-1)) is due to the interaction of water with a very polarized H (2) O molecule highly coordinated to the surface of Ca (2+) cations. On the surface dehydration, showing coordinative unsaturated (cus) Ca (2+) cation, H (2) O is the molecular adsorbed but more powerful (-Δ (ad) H ~ 120-90 kJ mol (-1)). The use of CO adsorption for measuring Lewis acid strength of the HA surface sites revealed only moderate force cus Ca (2+) cations, as confirmed by a second measurement microcalorimetric and IR spectroscopy and ab initio calculations.

These results indicate that HA / H (2) O great interaction energy is caused by the interaction between cus Ca (2+) site and the nearest PO hydrophilic (4) group, were not disclosed by the probe CO. Low density cus Ca (2+) cations at 573 K is activated HA surface with respect to one of pure does not affect the entire hydrophilicity of the surface, as the polarizing effect of Ca sites so strong as to extend up to four layers of hydrated, as confirmed by both microcalorimetric-high coverage and the data of IR spectroscopy. There are no special effects for specimens investigated methods of preparation and / or a different morphology were observed.

 Coordination chemistry of Ca sites at the surface of nanosized hydroxyapatite: interaction with H₂O and CO.
Coordination chemistry of Ca sites at the surface of nanosized hydroxyapatite: interaction with H₂O and CO.

Revisiting the alkaline earth metal isoreticular MOFs: a comprehensive study of phase stability, electronic structure, chemical bonding, and optical properties of A-IRMOF-1 (A = Be, Mg, Ca, Sr, Ba).

energy of formation, chemical bonds, the electronic structure and optical properties of the metal framework-organic alkaline earth metal, A-IRMOF-1 (where A = Be, Mg, Ca, Sr, or Ba), has been systematically investigated by the method of DFT , The volume of the unit cell and atomic positions are fully optimized with PERDEW-Burke-Ernzerhof functional. By fitting the data E-V into the equation Murnaghan, Birch and Universal countries (UEOS), the bulk modulus and its pressure derivative is expected and give almost the same results.

Data show that the series A-IRMOF-1 is a soft material. the estimated value of all the band gap of ca. 3.5 eV, a non-metallic exhibiting behavior that is essentially independent of this metal in the series A-IRMOF-1. formation energy calculated for the A-IRMOF-1 series -61.69 (Be), -62.53 (Mg), -66.56 (Ca), -65.34 (Sr), and -64.12 (Ba) kJ mol (-1) and substantially more negative than Zn based IRMOF-1 (MOF-5) at -46.02 kJ mol (-1). From the viewpoint of thermodynamics, the compound A-IRMOF-1 therefore even more stable than the famous MOF-5. Linear optical properties of the series A-IRMOF-1 systematically investigated.

The detailed analysis of the chemical bonds in the series A-IRMOF-1 reveals the nature of A-O, O-C, H-C and C-C bond, ie, A-O is primarily ionic interaction with metal dependence Covalency level. O-C, H-C and C-C bond interaction is as anticipated mainly covalent in character. Furthermore, it was found that the geometry and electronic structure of MOFs is now considered to be very sensitive to the k-point mesh involved in the calculation.

Recombinant Human ACE2
ACE2-736H-20ug 20ug
EUR 570
Description: Recombinant Human Angiotensin-Converting Enzyme 2/ACE-2 produced by transfected human cells is a secreted protein with sequence (Gln18-Ser740) of human ACE-2 fused with a polyhistidine tag at the C-terminus.The encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.
Recombinant Human ACE2 Protein
ACE2-185H-20ug 20ug
EUR 570
Description: Recombinant human ACE2 (NP_068576.1) (Met1-Ser740) was expressed with the Fc region of mouse IgG1 at the C-terminus.
Recombinant Human ACE2 Protein
ACE2-185H-50ug 50ug
EUR 830
Description: Recombinant human ACE2 (NP_068576.1) (Met1-Ser740) was expressed with the Fc region of mouse IgG1 at the C-terminus.
Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
DLR-ACE2-Hu-48T 48T
EUR 376
  • Should the Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiotensin I Converting Enzyme 2 (ACE2) in samples from serum, plasma or other biological fluids.
Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
DLR-ACE2-Hu-96T 96T
EUR 480
  • Should the Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiotensin I Converting Enzyme 2 (ACE2) in samples from serum, plasma or other biological fluids.
Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
DLR-ACE2-Mu-48T 48T
EUR 508
  • Should the Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Angiotensin I Converting Enzyme 2 (ACE2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
DLR-ACE2-Mu-96T 96T
EUR 661
  • Should the Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Angiotensin I Converting Enzyme 2 (ACE2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
DLR-ACE2-Ra-48T 48T
EUR 475
  • Should the Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Angiotensin I Converting Enzyme 2 (ACE2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
DLR-ACE2-Ra-96T 96T
EUR 616
  • Should the Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Angiotensin I Converting Enzyme 2 (ACE2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Hu-48Tests 48 Tests
EUR 362
Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Hu-96Tests 96 Tests
EUR 496
Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Mu-48Tests 48 Tests
EUR 511
Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Mu-96Tests 96 Tests
EUR 709
Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Ra-48Tests 48 Tests
EUR 473
Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Ra-96Tests 96 Tests
EUR 655
Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Hu-48Tests 48 Tests
EUR 378
Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Hu-96Tests 96 Tests
EUR 519
Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Mu-48Tests 48 Tests
EUR 534
Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Mu-96Tests 96 Tests
EUR 742
Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Ra-48Tests 48 Tests
EUR 495
Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Ra-96Tests 96 Tests
EUR 685
Ace2/ Rat Ace2 ELISA Kit
ELI-06051r 96 Tests
EUR 886
ACE2 Antibody
AF5165 200ul
EUR 304
Description: ACE2 Antibody detects endogenous levels of total ACE2.
ACE2 siRNA
20-abx900112
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ACE2 siRNA
20-abx906492
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ACE2 siRNA
20-abx906493
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ACE2 Antibody
ABF5165 100 ug
EUR 438
ACE2 antibody
70R-7469 50 ug
EUR 467
Description: Rabbit polyclonal ACE2 antibody
ACE2 Antibody
35524-100ul 100ul
EUR 390
ACE2 Antibody
36103-100ul 100ul
EUR 252
ACE2 Antibody
24214-100ul 100ul
EUR 390
ACE2 Antibody
24215-100ul 100ul
EUR 390
ACE2 Antibody
24220-100ul 100ul
EUR 390
ACE2 Antibody
24221-100ul 100ul
EUR 390
ACE2 antibody
70R-15539 50 ul
EUR 435
Description: Rabbit polyclonal ACE2 antibody
ACE2 Antibody
1-CSB-PA445794
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100
ACE2 Antibody
1-CSB-PA111496
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
ACE2 Antibody
1-CSB-PA040178
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
ACE2 Antibody
1-CSB-PA025395
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300
ACE2 Blocking Peptide
AF5165-BP 1mg
EUR 195
Polyclonal ACE2 Antibody
APR06331G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 . This antibody is tested and proven to work in the following applications:
Polyclonal ACE2 Antibody
APR06332G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 . This antibody is tested and proven to work in the following applications:
Polyclonal ACE2 Antibody
APR06333G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 . This antibody is tested and proven to work in the following applications:
Polyclonal ACE2 Antibody
APR06334G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 . This antibody is tested and proven to work in the following applications:
ACE2 Conjugated Antibody
C36103 100ul
EUR 397
anti- ACE2 antibody
FNab00081 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:10000
  • IP: 1:500-1:5000
  • Immunogen: angiotensin I converting enzyme(peptidyl-dipeptidase A) 2
  • Uniprot ID: Q9BYF1
  • Gene ID: 59272
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ACE2
ACE2 Polyclonal Antibody
ES7007-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACE2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
ACE2 Polyclonal Antibody
ES7007-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACE2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
ACE2 Polyclonal Antibody
ABP56008-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ACE2
  • Applications tips:
Description: A polyclonal antibody for detection of ACE2 from Human, Mouse. This ACE2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ACE2
ACE2 Polyclonal Antibody
ABP56008-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ACE2
  • Applications tips:
Description: A polyclonal antibody for detection of ACE2 from Human, Mouse. This ACE2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ACE2
ACE2 Polyclonal Antibody
ABP56008-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ACE2
  • Applications tips:
Description: A polyclonal antibody for detection of ACE2 from Human, Mouse. This ACE2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ACE2
ACE2 Blocking Peptide
20-abx061717
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
ACE2 (Middle) Antibody
abx022915-100ug 100 ug
EUR 746
  • Shipped within 5-10 working days.
ACE2 Rabbit pAb
A9454-100ul 100 ul
EUR 308
ACE2 Rabbit pAb
A9454-200ul 200 ul
EUR 459
ACE2 Rabbit pAb
A9454-20ul 20 ul Ask for price
ACE2 Rabbit pAb
A9454-50ul 50 ul Ask for price
ACE2 Inhibitor, DX600
9687-100
EUR 175
ACE2 Inhibitor, DX600
9687-1000
EUR 865
ACE2 Inhibitor, DX600
9687-500
EUR 512
ACE2 Rabbit pAb
A12737-100ul 100 ul
EUR 308
ACE2 Rabbit pAb
A12737-200ul 200 ul
EUR 459
ACE2 Rabbit pAb
A12737-20ul 20 ul
EUR 183
ACE2 Rabbit pAb
A12737-50ul 50 ul
EUR 223
ACE2 Rabbit mAb
A4612-100ul 100 ul
EUR 410
ACE2 Rabbit mAb
A4612-200ul 200 ul
EUR 571
ACE2 Rabbit mAb
A4612-20ul 20 ul
EUR 221
ACE2 Rabbit mAb
A4612-50ul 50 ul
EUR 287
ACE2 Blocking Peptide
33R-3121 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACE2 antibody, catalog no. 70R-7469
ACE2 cloning plasmid
CSB-CL866317HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2418
  • Sequence: ATGTCAAGCTCTTCCTGGCTCCTTCTCAGCCTTGTTGCTGTAACTGCTGCTCAGTCCACCATTGAGGAACAGGCCAAGACATTTTTGGACAAGTTTAACCACGAAGCCGAAGACCTGTTCTATCAAAGTTCACTTGCTTCTTGGAATTATAACACCAATATTACTGAAGAGAATG
  • Show more
Description: A cloning plasmid for the ACE2 gene.
Anti-ACE2 antibody
PAab00081 100 ug
EUR 355
pCMV-SPORT6-ACE2
PVT14449 2 ug
EUR 495
Anti-ACE2 antibody
STJ91442 200 µl
EUR 197
Description: Rabbit polyclonal to ACE2.
Anti-ACE2 antibody
STJ111706 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.
Anti-ACE2 antibody
STJ114610 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.
Anti-ACE2 Antibody
A2072-100 100 µg
EUR 394
Mouse ACE2 shRNA Plasmid
20-abx977106
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat ACE2 shRNA Plasmid
20-abx989155
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ACE2 ELISA Kit
EHA0506 96Tests
EUR 521
Human ACE2 ELISA Kit
ELA-E1886h 96 Tests
EUR 824
Goat ACE2 ELISA Kit
EGTA0506 96Tests
EUR 521
Canine ACE2 ELISA Kit
ECA0506 96Tests
EUR 521
Chicken ACE2 ELISA Kit
ECKA0506 96Tests
EUR 521
ACE2 (Human) ELISA Kit
E4528-100
EUR 805
Bovine ACE2 ELISA Kit
EBA0506 96Tests
EUR 521
Anserini ACE2 ELISA Kit
EAA0506 96Tests
EUR 521
ACE2 ELISA KIT|Human
EF000020 96 Tests
EUR 689
Rat ACE2 ELISA Kit
ERA0506 96Tests
EUR 521
Rabbit ACE2 ELISA Kit
ERTA0506 96Tests
EUR 521
Sheep ACE2 ELISA Kit
ESA0506 96Tests
EUR 521
Porcine ACE2 ELISA Kit
EPA0506 96Tests
EUR 521
Mouse ACE2 ELISA Kit
EMA0506 96Tests
EUR 521
Monkey ACE2 ELISA Kit
EMKA0506 96Tests
EUR 521
ACE2 (SARS Receptor) Antibody
abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
ACE2 (SARS Receptor) Antibody
abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
ACE2 (C-Term) Antibody
abx022916-100ug 100 ug
EUR 878
  • Shipped within 5-10 working days.
ACE2 (N-Term) Antibody
abx022917-100ug 100 ug
EUR 801
  • Shipped within 5-10 working days.
Human ACE2 shRNA Plasmid
20-abx961760
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ACE2 Antibody, HRP conjugated
1-CSB-PA866317LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ACE2 Antibody, FITC conjugated
1-CSB-PA866317LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ACE2 Antibody, Biotin conjugated
1-CSB-PA866317LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human ACE2 ELISA Kit
LF-EK70020 1×96T
EUR 602
ACE2 Recombinant Protein (Human)
RP036397 100 ug Ask for price
ACE2 Recombinant Protein (Rat)
RP188834 100 ug Ask for price
pMD18-T-ACE2 Plasmid
PVTB00628 2 ug
EUR 356
ACE2 Recombinant Protein (Mouse)
RP113765 100 ug Ask for price
ACE2 Recombinant Protein (Mouse)
RP113768 100 ug Ask for price
Monoclonal ACE2 Antibody, Clone: 881CT16.4.4
AMM02457G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human ACE2. The antibodies are raised in Mouse and are from clone 881CT16.4.4. This antibody is applicable in WB, E
ELISA kit for Human ACE2
EK5468 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ACE2 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Mouse ACE2
EK5518 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse ACE2 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human ACE2 PicoKine ELISA Kit
EK0997 96 wells
EUR 455
Description: For quantitative detection of human ACE2 in cell culture supernates, serum and plasma(heparin).
Mouse ACE2 PicoKine ELISA Kit
EK1188 96 wells
EUR 455
Description: For quantitative detection of Mouse ACE2 in cell culture supernates, serum and plasma(heparin).
Guinea Pig ACE2 ELISA Kit
EGA0506 96Tests
EUR 521
Anti-ACE2 Rabbit Monoclonal Antibody
M00756 100ug/vial
EUR 397
Description: Rabbit Monoclonal ACE2 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Ace2 ORF Vector (Mouse) (pORF)
ORF037923 1.0 ug DNA
EUR 506
Ace2 ORF Vector (Mouse) (pORF)
ORF037924 1.0 ug DNA
EUR 506
ACE2 ORF Vector (Human) (pORF)
ORF012133 1.0 ug DNA
EUR 354
Ace2 ORF Vector (Rat) (pORF)
ORF062946 1.0 ug DNA
EUR 506
pECMV-Ace2-m-FLAG Plasmid
PVT15343 2 ug
EUR 325
ACE2 ELISA Kit (Rat) (OKAN05651)
OKAN05651 96 Wells
EUR 792
Description: Description of target: enzyme peptidyl-dipeptidase; mouse homolog has a role in regulation of cardiac contractility and regulating Angiotensin 1 and 2 levels [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL
ACE2 ELISA Kit (Human) (OKAN05734)
OKAN05734 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.4 pg/mL
ACE2 ELISA Kit (Mouse) (OKAN05813)
OKAN05813 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.5 pg/mL
ACE2 ELISA Kit (Human) (OKCD07767)
OKCD07767 96 Wells
EUR 544
Description: Description of target: ACE2 belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63. The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This protein catalyzes the cleavage of angiotensin I into angiotensin 1-9. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.4pg/mL
ACE2 ELISA Kit (Mouse) (OKCD07768)
OKCD07768 96 Wells
EUR 818
Description: Description of target: AngiotensinI-converting enzyme 2 (ACE 2) is a protein belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. By sequence similarity to a sequence in GenBank, this gene is mapped to Xp22.2. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.7pg/mL
ACE2 ELISA Kit (Rat) (OKCD07769)
OKCD07769 96 Wells
EUR 1001
Description: Description of target: enzyme peptidyl-dipeptidase; mouse homolog has a role in regulation of cardiac contractility and regulating Angiotensin 1 and 2 levels.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL
ACE2 ELISA Kit (Human) (OKBB00649)
OKBB00649 96 Wells
EUR 544
Description: Description of target: AngiotensinI-converting enzyme 2 (ACE 2) is a protein belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. By sequence similarity to a sequence in GenBank, this gene is mapped to Xp22.2. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL
ACE2 ELISA Kit (Mouse) (OKBB00657)
OKBB00657 96 Wells
EUR 544
Description: Description of target: AngiotensinI-converting enzyme 2 (ACE 2) is a protein belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. By sequence similarity to a sequence in GenBank, this gene is mapped to Xp22.2. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL
ACE2 ELISA Kit (Mouse) (OKEH06836)
OKEH06836 96 Wells
EUR 662
Description: Description of target: Carboxypeptidase which converts angiotensin I to angiotensin 1-9, a peptide of unknown function, and angiotensin II to angiotensin 1-7, a vasodilator. Also able to hydrolyze apelin-13 and dynorphin-13 with high efficiency. May be an important regulator of heart function. May have a protective role in acute lung injury.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.174 ng/mL
Polyclonal ACE2 / ACE-2 Antibody (Internal)
APR02229G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 / ACE-2 (Internal). This antibody is tested and proven to work in the following applications:
Polyclonal ACE2 / ACE-2 Antibody (Internal)
APR02552G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 / ACE-2 (Internal). This antibody is tested and proven to work in the following applications:
Polyclonal ACE2 (SARS Receptor) Antibody (Center)
APR05696G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 (SARS Receptor) (Center). This antibody is tested and proven to work in the following applications:
ACE2 sgRNA CRISPR Lentivector set (Human)
K0028501 3 x 1.0 ug
EUR 339
Angiotensin-Converting Enzyme 2 (ACE2) Antibody
20-abx313823
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ace2 sgRNA CRISPR Lentivector set (Mouse)
K4049101 3 x 1.0 ug
EUR 339
Rabbit anti-Human ACE2 Polyclonal antibody
1-CSB-PA866317LA01HU
  • Ask for price
  • Ask for price
  • 100ug
  • 50ug
  • Purification Method: >95%, Protein G purified
  • Concentration: It differs from different batches. Please contact us to confirm it.
  • Buffer: Preservative: 0.03% Proclin 300: Constituents: 50% Glycerol, 0.01M PBS, PH 7.4
  • Form: Liquid
  • Tested Applications:
  • Show more
Description: Human ACE2 Polyclonal antibody is raised in rabbit, and it is tested for ELISA, IHC and IF.
Rabbit anti-Human ACE2 Polyclonal antibody
1-CSB-PA001150GA01HU
  • Ask for price
  • Ask for price
  • 150ul
  • 50ul
  • Purification Method: Antigen Affinity purified
  • Concentration: It differs from different batches. Please contact us to confirm it.
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3
  • Tested Applications: ELISA,WB
Description: Human ACE2 Polyclonal antibody is raised in rabbit, and it is tested for ELISA and WB.
Ace2 sgRNA CRISPR Lentivector set (Rat)
K7372001 3 x 1.0 ug
EUR 339
Polyclonal ACE2 / ACE-2 Antibody (N-Terminus)
APR02551G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 / ACE-2 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal ACE2 (SARS Receptor) Antibody (N-term)
APR05695G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 (SARS Receptor) (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal ACE2 (SARS Receptor) Antibody (C-term)
APR05697G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 (SARS Receptor) (C-term). This antibody is tested and proven to work in the following applications:
ACE2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0028502 1.0 ug DNA
EUR 154
ACE2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0028503 1.0 ug DNA
EUR 154
ACE2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0028504 1.0 ug DNA
EUR 154
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
20-abx124742
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
20-abx130296
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
20-abx110980
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
abx122694-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
20-abx141019
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
20-abx171234
  • EUR 704.00
  • EUR 356.00
  • 1 mg
  • 200 ug
  • Please enquire.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
20-abx171235
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
20-abx103398
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
abx034794-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
abx034794-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
abx034955-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
abx037560-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
abx032685-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
abx032685-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
20-abx175394
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
20-abx175395
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Angiotensin I Converting Enzyme 2 (ACE2) Antibody
20-abx325574
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Angiotensin-Converting Enzyme 2 (ACE2) Antibody (HRP)
20-abx313824
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Angiotensin-Converting Enzyme 2 (ACE2) Antibody (FITC)
20-abx313825
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Angiotensin-Converting Enzyme 2 (ACE2) Antibody (Biotin)
20-abx313826
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Importantly, this indicates that the sample with the Γ-point will only provide reliable structural properties of MOFs. Thus, the computational simulation should be readily extended to the MOF system even more complicated.