Structural and thermodynamic study of Ca A- or Co B-site substituted SrFeO3-δ perovskites for low temperature chemical looping applications.

Perovskite-structured materials, because the chemical-physical properties and composition tuneable, have expanded their range of applications for the chemical looping process, in which the lattice oxygen supply of oxygen required for the chemical reaction to eliminate the use of co-feeding oxidant gas.

To optimize the behavior of oxygen donate them for specific applications a fundamental understanding of the characteristics of the reduction / oxidation of perovskite structured oxides and their manipulation through the introduction of dopants is key. In this study, we investigate the nature of the desorption / absorption of structural and oxygen from SR1-xCaxFeO3-δ and SrFe1-xCoxO3-δ (0 ≤ x ≤ 1) to guide the design of more effective oxygen carriers for chemical looping applications at low temperature (ie 400- 600 ° C). Ca A- or B-site co-delta replaced SrFeO3 show reducibility increases, so that a higher oxygen capacity at T ≤ 600 ° C when compared to samples substituted.

Quantitative assessment of the thermodynamic properties (partial molar enthalpy and entropy of vacancy formation) confirms the reduced formation enthalpy of a vacancy on the substitution in the temperature range (ie, 400-600 ° C). Among the samples tested, Sr0.8Ca0.2FeO3-δ exhibited the highest oxygen storage capacity (2.15 wt%) at 500 ° C, equipped with a redox excellent and the structural stability of more than 100 cycles. Rate thermodynamics, supported by in situ XRD measurements revealed that the release of oxygen occurs in the transition phase of perovskite-brownmillerite below 770 ° C, while the perovskite structure remains stable above 770 ° C.

 Structural and thermodynamic study of Ca A- or Co B-site substituted SrFeO3-δ perovskites for low temperature chemical looping applications.
Structural and thermodynamic study of Ca A- or Co B-site substituted SrFeO3-δ perovskites for low temperature chemical looping applications.

Chemical Modifications in RNA Interference and CRISPR / Cas Genome Editing Reagents.

chemically modified oligonucleotides (ONS) are routinely used in the laboratory to assess gene function, and clinical progress fast forward as the continuous efforts undertaken to optimize the efficacy ON. For years, RNA interference (RNAi) has become one of the main tools used to inhibit RNA expression in various species.

Attempts have been made to improve the administration of exogenous double-stranded RNA component by intracellular endogenous RNAi machinery to direct degradation of the target RNA efficacious user defined. More recently, synthetic RNA ons used to replicate system CRISPR / Cas-derived bacteria specific to directly edit the mammalian genome. Both of these techniques rely on the use of various chemical modification to RNA phosphate backbone or sugar in certain positions throughout ons to enhance the desired biological outcome.

Relevant chemical modifications also include a targeting ligand conjugated to help ON delivery to specific cell types. chemical modification that is most beneficial for ounce therapies that are relevant, because they serve to enhance the binding targets, increased longevity drugs, facilitating the targeting cell-specific, increasing internalization into the compartment intracellular productive, and reduces both sequence-specific and related to the immune target effects (OTES).

SAE1 antibody

22850-100ul 100ul
EUR 390

SAE1 Antibody

25115-100ul 100ul
EUR 390

SAE1 antibody

70R-13557 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SAE1 antibody

SAE1 antibody

70R-20073 50 ul
EUR 435
Description: Rabbit polyclonal SAE1 antibody

SAE1 antibody

70R-3174 50 ug
EUR 467
Description: Rabbit polyclonal SAE1 antibody raised against the N terminal of SAE1

SAE1 Antibody

36160-100ul 100ul
EUR 252

SAE1 antibody

10R-1641 50 ug
EUR 242
Description: Mouse monoclonal SAE1 antibody

SAE1 Antibody

49894-100ul 100ul
EUR 333

SAE1 Antibody

49894-50ul 50ul
EUR 239

SAE1 Antibody

1-CSB-PA004045
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SAE1. Recognizes SAE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

SAE1 Antibody

1-CSB-PA883359ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SAE1. Recognizes SAE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SAE1 Antibody

1-CSB-PA897667
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SAE1. Recognizes SAE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50

SAE1 Antibody

CSB-PA794022-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SAE1. Recognizes SAE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

SAE1 Antibody

CSB-PA794022-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SAE1. Recognizes SAE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

SAE1 Antibody

1-CSB-PA493084
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SAE1. Recognizes SAE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

SAE1 antibody

70R-3589 50 ug
EUR 467
Description: Rabbit polyclonal SAE1 antibody raised against the N terminal of SAE1

SAE1 antibody

70R-50768 100 ul
EUR 244
Description: Purified Polyclonal SAE1 antibody

SAE1 Antibody

1-CSB-PA020666GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SAE1. Recognizes SAE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SAE1 siRNA

20-abx904767
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SAE1 siRNA

20-abx932396
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SAE1 siRNA

20-abx932397
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-SAE1

PVT18520 2 ug
EUR 231

anti-SAE1

YF-PA16682 50 ul
EUR 363
Description: Mouse polyclonal to SAE1

anti-SAE1

YF-PA16683 50 ug
EUR 363
Description: Mouse polyclonal to SAE1

anti-SAE1

YF-PA16684 100 ug
EUR 403
Description: Rabbit polyclonal to SAE1

SAE1 Blocking Peptide

33R-9854 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SAE1 antibody, catalog no. 70R-3589

SAE1 Blocking Peptide

33R-6581 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SAE1 antibody, catalog no. 70R-3174

SAE1 Blocking Peptide

20-abx063643
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

SAE1 Conjugated Antibody

C49894 100ul
EUR 397

SAE1 Conjugated Antibody

C36160 100ul
EUR 397

Polyclonal SAE1 Antibody

APR06630G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAE1 . This antibody is tested and proven to work in the following applications:

SAE1 cloning plasmid

CSB-CL883359HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atggtggagaaggaggaggctggcggcggcattagcgaggaggaggcggcacagtatgaccggcagatccgcctgtggggactggaggcccagaaacggctgcgggcctctcgggtgcttcttgtcggcttgaaaggacttggggctgaaattgccaagaatctcatcttggcag
  • Show more
Description: A cloning plasmid for the SAE1 gene.

SAE1 Polyclonal Antibody

ABP52405-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human SAE1 at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of SAE1 from Human, Mouse, Rat. This SAE1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SAE1 at AA range: 190-270

SAE1 Polyclonal Antibody

ABP52405-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human SAE1 at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of SAE1 from Human, Mouse, Rat. This SAE1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SAE1 at AA range: 190-270

SAE1 Polyclonal Antibody

ABP52405-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human SAE1 at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of SAE1 from Human, Mouse, Rat. This SAE1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SAE1 at AA range: 190-270

SAE1 Rabbit pAb

A9960-100ul 100 ul
EUR 308

SAE1 Rabbit pAb

A9960-200ul 200 ul
EUR 459

SAE1 Rabbit pAb

A9960-20ul 20 ul
EUR 183

SAE1 Rabbit pAb

A9960-50ul 50 ul
EUR 223

anti- SAE1 antibody

FNab07577 100µg
EUR 548.75
  • Immunogen: SUMO1 activating enzyme subunit 1
  • Uniprot ID: Q9UBE0
  • Gene ID: 10055
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against SAE1

SAE1 Polyclonal Antibody

ES3404-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SAE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

SAE1 Polyclonal Antibody

ES3404-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SAE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-SAE1 antibody

PAab07577 100 ug
EUR 386

Anti-SAE1 antibody

STJ112001 100 µl
EUR 277

Anti-SAE1 antibody

STJ95572 200 µl
EUR 197
Description: Rabbit polyclonal to SAE1.

SAE1 protein (T7 tag)

80R-1373 50 ug
EUR 305
Description: Purified recombinant Human SAE1 protein (T7 tag)

Human SAE1 ELISA Kit

ELA-E3292h 96 Tests
EUR 824

SAE1 ELISA KIT|Human

EF006330 96 Tests
EUR 689

Rat SAE1 shRNA Plasmid

20-abx989482
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SAE1 shRNA Plasmid

20-abx974789
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SAE1 shRNA Plasmid

20-abx956771
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti-SAE1 (1G4-1G5)

LF-MA10294 100 ug
EUR 363
Description: Mouse monoclonal to SAE1

SAE1 Recombinant Protein (Human)

RP027547 100 ug Ask for price

SAE1 Recombinant Protein (Rat)

RP227408 100 ug Ask for price

SAE1 Recombinant Protein (Mouse)

RP169883 100 ug Ask for price

Anti-SAE1 / AOS1 antibody

STJ70426 100 µg
EUR 359

Sae1 ORF Vector (Rat) (pORF)

ORF075804 1.0 ug DNA
EUR 506

SAE1 ORF Vector (Human) (pORF)

ORF009183 1.0 ug DNA
EUR 95

Sae1 ORF Vector (Mouse) (pORF)

ORF056629 1.0 ug DNA
EUR 506

SAE1 ELISA Kit (Rat) (OKEH05998)

OKEH05998 96 Wells
EUR 662
Description: Description of target: The heterodimer acts as an E1 ligase for SUMO1, SUMO2, SUMO3, and probably SUMO4. It mediates ATP-dependent activation of SUMO proteins followed by formation of a thioester bond between a SUMO protein and a conserved active site cysteine residue on UBA2/SAE2.

This subsection of the ‘Function’ section describes the metabolic pathway(s) associated with a protein.

More..;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084 ng/mL

SAE1 ELISA Kit (Mouse) (OKEH05127)

OKEH05127 96 Wells
EUR 662
Description: Description of target: The heterodimer acts as an E1 ligase for SUMO1, SUMO2, SUMO3, and probably SUMO4. It mediates ATP-dependent activation of SUMO proteins followed by formation of a thioester bond between a SUMO protein and a conserved active site cysteine residue on UBA2/SAE2.

This subsection of the ‘Function’ section describes the metabolic pathway(s) associated with a protein.

More..;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL

SAE1 ELISA Kit (Human) (OKEH01703)

OKEH01703 96 Wells
EUR 662
Description: Description of target: Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1, MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Polyclonal SAE1 (AOS1) Antibody (C-term)

APR05045G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAE1 (AOS1) (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-SAE1 / AOS1 Antibody

APG00292G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-SAE1 / AOS1 . This antibody is tested and proven to work in the following applications:

Sae1 sgRNA CRISPR Lentivector set (Mouse)

K4660701 3 x 1.0 ug
EUR 339

Sae1 sgRNA CRISPR Lentivector set (Rat)

K6300701 3 x 1.0 ug
EUR 339

SAE1 sgRNA CRISPR Lentivector set (Human)

K2085501 3 x 1.0 ug
EUR 339

Human SUMO-activating enzyme subunit 1 (SAE1)

1-CSB-EP883359HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human SUMO-activating enzyme subunit 1(SAE1) expressed in E.coli

SUMO-Activating Enzyme Subunit 1 (SAE1) Antibody

20-abx008366
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

SUMO-Activating Enzyme Subunit 1 (SAE1) Antibody

20-abx135880
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

SUMO-Activating Enzyme Subunit 1 (SAE1) Antibody

abx031607-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SUMO-Activating Enzyme Subunit 1 (SAE1) Antibody

abx031607-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SUMO-Activating Enzyme Subunit 1 (SAE1) Antibody

abx237577-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SUMO-activating enzyme subunit 1 (SAE1) Antibody

20-abx241829
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

SUMO-activating enzyme subunit 1 (SAE1) Antibody

20-abx241917
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

SUMO-Activating Enzyme Subunit 1 (SAE1) Antibody

20-abx321167
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

SUMO-activating enzyme subunit 1 (SAE1) Antibody

20-abx329440
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

SUMO-activating enzyme subunit 1 (SAE1) Antibody

abx332268-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

SUMO-Activating Enzyme Subunit 1 (SAE1) Antibody

abx430292-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Monoclonal SAE1 Antibody (clone 1G8), Clone: 1G8

AMM02208G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human SAE1 (clone 1G8). The antibodies are raised in Mouse and are from clone 1G8. This antibody is applicable in WB and IHC-P, IF

Sae1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4660702 1.0 ug DNA
EUR 154

Sae1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4660703 1.0 ug DNA
EUR 154

Sae1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4660704 1.0 ug DNA
EUR 154

Sae1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6300702 1.0 ug DNA
EUR 154

Sae1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6300703 1.0 ug DNA
EUR 154

Sae1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6300704 1.0 ug DNA
EUR 154

SAE1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2085502 1.0 ug DNA
EUR 154

SAE1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2085503 1.0 ug DNA
EUR 154

SAE1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2085504 1.0 ug DNA
EUR 154

SAE1 Protein Vector (Rat) (pPB-C-His)

PV303214 500 ng
EUR 603

SAE1 Protein Vector (Rat) (pPB-N-His)

PV303215 500 ng
EUR 603

SAE1 Protein Vector (Rat) (pPM-C-HA)

PV303216 500 ng
EUR 603

SAE1 Protein Vector (Rat) (pPM-C-His)

PV303217 500 ng
EUR 603

SAE1 Protein Vector (Mouse) (pPB-C-His)

PV226514 500 ng
EUR 603

SAE1 Protein Vector (Mouse) (pPB-N-His)

PV226515 500 ng
EUR 603

SAE1 Protein Vector (Mouse) (pPM-C-HA)

PV226516 500 ng
EUR 603

SAE1 Protein Vector (Mouse) (pPM-C-His)

PV226517 500 ng
EUR 603

SAE1 Protein Vector (Human) (pPB-C-His)

PV036729 500 ng
EUR 329

SAE1 Protein Vector (Human) (pPB-N-His)

PV036730 500 ng
EUR 329

SAE1 Protein Vector (Human) (pPM-C-HA)

PV036731 500 ng
EUR 329

SAE1 Protein Vector (Human) (pPM-C-His)

PV036732 500 ng
EUR 329

Recombinant Human SAE1 Protein, GST, E.coli-100ug

QP8183-ec-100ug 100ug
EUR 408

Recombinant Human SAE1 Protein, GST, E.coli-10ug

QP8183-ec-10ug 10ug
EUR 200

Recombinant Human SAE1 Protein, GST, E.coli-1mg

QP8183-ec-1mg 1mg
EUR 1632

Recombinant Human SAE1 Protein, GST, E.coli-200ug

QP8183-ec-200ug 200ug
EUR 634

Recombinant Human SAE1 Protein, GST, E.coli-500ug

QP8183-ec-500ug 500ug
EUR 1060

Recombinant Human SAE1 Protein, GST, E.coli-50ug

QP8183-ec-50ug 50ug
EUR 263

Sae1 3'UTR Luciferase Stable Cell Line

TU118316 1.0 ml Ask for price

Sae1 3'UTR GFP Stable Cell Line

TU168316 1.0 ml Ask for price

Sae1 3'UTR Luciferase Stable Cell Line

TU219892 1.0 ml Ask for price

Sae1 3'UTR GFP Stable Cell Line

TU269892 1.0 ml Ask for price

SAE1 3'UTR GFP Stable Cell Line

TU072554 1.0 ml
EUR 1394

SAE1 3'UTR Luciferase Stable Cell Line

TU022554 1.0 ml
EUR 1394

Monoclonal SAE1 Antibody (monoclonal) (M01), Clone: 1G4-1G5

AMM04068G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SAE1 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1G4-1G5. This antibody is applicable in WB, IHC and IF, E

SAE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV695755 1.0 ug DNA
EUR 682

SAE1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV695759 1.0 ug DNA
EUR 682

SAE1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV695760 1.0 ug DNA
EUR 682

Human SUMO-activating enzyme subunit 1 (SAE1) ELISA Kit

abx251614-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human SAE1(SUMO-activating enzyme subunit 1) ELISA Kit

EH2266 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9UBE0
  • Alias: SAE1/AOS1/SUA1/UBA2/UBLE1A/AOS1activator of SUMO1/FLJ3091/HSPC140/Sua1/SUA1sentrin/SUMO-activating protein AOS1/SUMO-1 activating enzyme E1 N subunit/SUMO1 activating enzyme subunit 1/SUMO-1 a
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human SAE1/ SUMO-activating enzyme subunit 1 ELISA Kit

E2210Hu 1 Kit
EUR 571

Bovine SUMO- activating enzyme subunit 1, SAE1 ELISA KIT

ELI-18883b 96 Tests
EUR 928

Cow SUMO-activating enzyme subunit 1 (SAE1) ELISA Kit

abx520274-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse SUMO-activating enzyme subunit 1 (SAE1) ELISA Kit

abx520276-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat SUMO-activating enzyme subunit 1 (SAE1) ELISA Kit

abx520277-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human SUMO- activating enzyme subunit 1, SAE1 ELISA KIT

ELI-39248h 96 Tests
EUR 824

Mouse SUMO- activating enzyme subunit 1, Sae1 ELISA KIT

ELI-41543m 96 Tests
EUR 865

SAE1 SUMO1 Activating Enzyme Subunit 1 Human Recombinant Protein

PROTQ9UBE0 Regular: 10ug
EUR 317
Description: SAE1 Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 378 amino acids (1-346 a.a.) and having a molecular mass of 42.2 kDa. The SAE1 is fused to 32 amino acid T7-Tag at N-terminus and purified by proprietary chromatographic techniques. _x000D_

Sae1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4660705 3 x 1.0 ug
EUR 376

Sae1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6300705 3 x 1.0 ug
EUR 376

SAE1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2085505 3 x 1.0 ug
EUR 376

Sae1 ELISA Kit| Rat SUMO-activating enzyme subunit 1 ELISA Kit

EF019390 96 Tests
EUR 689

Sae1 ELISA Kit| Mouse SUMO-activating enzyme subunit 1 ELISA Ki

EF016320 96 Tests
EUR 689

SAE1 ELISA Kit| Bovine SUMO-activating enzyme subunit 1 ELISA K

EF011944 96 Tests
EUR 689

SAE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV695756 1.0 ug DNA
EUR 682

SAE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV695757 1.0 ug DNA
EUR 740

SAE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV695758 1.0 ug DNA
EUR 740

Sae1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4660706 1.0 ug DNA
EUR 167

Sae1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4660707 1.0 ug DNA
EUR 167

Sae1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4660708 1.0 ug DNA
EUR 167

Sae1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6300706 1.0 ug DNA
EUR 167

Sae1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6300707 1.0 ug DNA
EUR 167

Sae1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6300708 1.0 ug DNA
EUR 167

SAE1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2085506 1.0 ug DNA
EUR 167

SAE1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2085507 1.0 ug DNA
EUR 167

SAE1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2085508 1.0 ug DNA
EUR 167

The knowledge gained from years of RNAi reagents to optimize and characterize the properties of biochemistry and biophysics of any chemical modifications will hopefully speed up the CRISPR / Cas technology to the clinic, as well as expanding the use of RNAi to treat the disease when undruggable. This review discusses the most common chemical modification used in RNAi reagents and CRISPR / Cas RNA guide and provide an overview of select publications that have shown success in improving ON efficacy and / or reduce unwanted OTES.